WormBase Tree Display for Variation: WBVar02123768
expand all nodes | collapse all nodes | view schema
WBVar02123768 | Name | Public_name | WBVar02123768 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854691 | |||||||
HGVSg | CHROMOSOME_IV:g.2851003_2861002del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | ||||
Flanking_sequences | AATCACAAAAGAATACGCCGAGCACAATTG | CCGACCACAGACCAATAAGATTATGGATCT | ||||||
Mapping_target | Y54G2A | |||||||
Source_location | 225 | CHROMOSOME_IV | 2851001 | 2861000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022887 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044495 | ||||||
WBGene00021872 | ||||||||
WBGene00021881 | ||||||||
WBGene00044492 | ||||||||
Transcript | Y54G2A.49b.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 1-5/5 | |||||||
Y54G2A.16c.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-2/2 | |||||||
Exon_number | 1-3/3 | |||||||
Y54G2A.16b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-4/5 | |||||||
Exon_number | 2-6/6 | |||||||
Y54G2A.40.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 1667-? | |||||||
CDS_position | 1599-? | |||||||
Protein_position | 533-? | |||||||
Exon_number | 9/9 | |||||||
Y54G2A.6a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | 118-? | |||||||
Intron_number | 1-5/6 | |||||||
Exon_number | 1-7/7 | |||||||
Y54G2A.16a.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-3/4 | |||||||
Exon_number | 1-5/5 | |||||||
Y54G2A.6b.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/1 | |||||||
Exon_number | 1-2/2 | |||||||
Y54G2A.49a.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/2 | |||||||
Exon_number | 1-3/3 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |