WormBase Tree Display for Variation: WBVar02123798
expand all nodes | collapse all nodes | view schema
WBVar02123798 | Name | Public_name | WBVar02123798 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854721 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | TAGAGCAGTCATCGCTCGATGGCAATCCGT | > | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 13769001 | 13784000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022899 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00007066 | ||||||
WBGene00007065 | ||||||||
WBGene00007025 | ||||||||
WBGene00003967 | ||||||||
WBGene00197401 | ||||||||
WBGene00305233 | ||||||||
WBGene00045172 | ||||||||
WBGene00000875 | ||||||||
Transcript (12) | ||||||||
Pseudogene | 3R5.2 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |