WormBase Tree Display for Variation: WBVar02124582
expand all nodes | collapse all nodes | view schema
WBVar02124582 | Name | Public_name | WBVar02124582 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855505 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | ||||
Flanking_sequences | TCATTCTTTTGGTTTGAAGTCGTAGGATTC | TACCTACAGCTTAACTATTTTTTCCAAATT | ||||||
Mapping_target | Y54G2A | |||||||
Source_location | 225 | CHROMOSOME_IV | 2816001 | 2828000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027660 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00043062 | ||||||
WBGene00021878 | ||||||||
WBGene00023484 | ||||||||
WBGene00171446 | ||||||||
Transcript | Y54G2A.37.1 | |||||||
Y54G2A.39b.1 | ||||||||
Y54G2A.39a.1 | ||||||||
Y54G2A.13.1 | ||||||||
Y54G2A.55 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |