WormBase Tree Display for Variation: WBVar02124583
expand all nodes | collapse all nodes | view schema
WBVar02124583 | Name | Public_name | WBVar02124583 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855506 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | ||||
Flanking_sequences | TTTTTCTGGACCTAGATGTCAATTTTCAGA | CGCGCTACAGGGGTTTTTGTCTTGAATTCC | ||||||
Mapping_target | Y54G2A | |||||||
Source_location | 225 | CHROMOSOME_IV | 2820049 | 2820216 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027660 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |