WormBase Tree Display for Variation: WBVar02125052

WBVar02125052 Evidence: Paper_evidence: WBPaper00042428
  Name: Public_name: kc2
    Other_name: F42C5.10.1:c.79C>T
      CE28393:p.Arg27Ter
    HGVSg: CHROMOSOME_IV:g.7326584G>A
  Sequence_details: SMap: S_parent: Sequence: Y40C5A
    Flanking_sequences: cagaaatgtgtggacttggatgaacaaatt gaagagagaatgatgtaagttgtgttcaag
    Mapping_target: Y40C5A
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00040999
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: BJ
    Status: Live
  Affects: Gene: WBGene00018350
    Transcript: F42C5.10.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F42C5.10.1:c.79C>T
        HGVSp: CE28393:p.Arg27Ter
        cDNA_position: 80
        CDS_position: 79
        Protein_position: 27
        Exon_number: 2/15
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
  Genetics: Interpolated_map_position: IV 3.32339
  Description: Phenotype: WBPhenotype:0000425 Paper_evidence: WBPaper00040999
        Curator_confirmed: WBPerson2987
        Remark: " To examine the expression of endogenous IFO-1 , antibodies were generated against peptides 1 ( position 19-39 ) and 2 ( position 386-405 ; Fig . 2Bfi ) . These antibodies stained the intestine in the same fashion as the reporters and anti-IFB-2 antibodies ( Fig . 2C- D fl , Fig . 3A-Dfi , Fig . 4A-Afl ) . IFO-1 fluorescence was severely reduced in kc3 ( Fig . 4B-Bfl ) and completely absent in kc2 ( Fig . 4C- C fl ) ." Paper_evidence: WBPaper00040999
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000679 Paper_evidence: WBPaper00040999
        Curator_confirmed: WBPerson2987
        Remark: "Alleles kc2 ( strain BJ133 ) and kc3 ( strain BJ134 ) exhibited aberrant IFB-2 : : CFP distribution ( Fig . 1C-F ) . IFB-2 : : CFP was almost absent from the apical domain in kc2 mutants . Instead , it accumulated in the cytoplasm in form of granules and presented a continuous junction- like enrichment at the apical cell-cell borders ( Fig . 1C,D ) . During early morphogenesis ( 1.5-fold stage ) , IFB-2-labeling surrounded the entire intestinal lumen in the WT ( Fig . 1G ) , whereas only fluorescent spots were seen at the apical domain of intestinal cells of kc2 mutants ( Fig . 1J ) . Differences persisted during later embryonal and larval stages when a junction-like IFB-2 distribution developed and multiple cytoplasmic granules appeared in the mutant ( Fig . 1K,L ) . By contrast , perilumenal fluorescence was maintained in the WT throughout ( Fig . 1H,I ) . Cytoplasmic granules were also frequently seen in the WT . In comparison to kc2 mutants , the altered IFB-2 : : CFP phenotype was less prominent in kc3 homozygotes becoming manifest only in young adult worms ( Fig . 1F ) and progressing in older worms . " Paper_evidence: WBPaper00040999
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Control_strain: WBStrain00042349 Paper_evidence: WBPaper00040999
              Curator_confirmed: WBPerson2987
          Genotype: kcIs21 [ifb-2::cfp] V Paper_evidence: WBPaper00040999
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001354 Paper_evidence: WBPaper00040999
        Curator_confirmed: WBPerson2987
        Remark: " Given the endotube loss in kc2 mutants , we therefore analyzed actin distribution in dissected adult intestines by phalloidin staining . In kc2 mutants , the phalloidin staining was significantly reduced ( Fig . 9A-C ) . This observation was further corroborated by immunofluorescence microscopy using monoclonal actin antibodies ( Fig . 9D-F ) . The reduction was intestine-specific , as it was not observed in other tissues and was not detected by immunoblotting of total worm lysates ( data not shown ) . A decrease of phalloidin staining ( mean intensity / pixel ) was also observed in kc2 mutant embryos ( Fig . 9I,Ifi ; 55,957 plus / minus 731 , n 5 ; P <0.0001 versus 82,186 plus / minus 1785 in WT , n 5 ) ." Paper_evidence: WBPaper00040999
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001403 Paper_evidence: WBPaper00040999
        Curator_confirmed: WBPerson2987
        Remark: "To show that overexpression of the IFB-2 : : CFP reporter is not responsible for the ifo-1 -phenotype , the mutant alleles kc2 and kc3 were outcrossed into the WT background . In the resulting strains , BJ142 ( kc2 ) and BJ143 ( kc3 ) , anti-IFB-2 immunofluorescence showed the same type of mislocalization as in the reporter strains , although the number of cytoplasmic aggregates was slightly reduced ( e.g . Fig . 5B ) ." Paper_evidence: WBPaper00040999
            Curator_confirmed: WBPerson2987
      WBPhenotype:0002216 Paper_evidence: WBPaper00040999
        Curator_confirmed: WBPerson2987
        Remark: " The development of IFB-2 mislocalization was then examined in kc2 and kc3 mutant embryos in relation to the CeAJ ( Fig . 6 ) . In contrast to the WT situation ( Fig . 1G ; Fig . 3B,C,D ; Fig . 6G-G fl ) , IFB-2 did not accumulate homogenously at the cell apex but was first detected as multiple puncta in proximity to junctional DLG-1 at the 1.5-fold stage of kc2 mutants ( Fig . 6A-A fi , Fig . 1J ) ." Paper_evidence: WBPaper00040999
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00040999
  Method: Substitution_allele