WormBase Tree Display for Variation: WBVar02125106
expand all nodes | collapse all nodes | view schema
| WBVar02125106 | Evidence | Paper_evidence | WBPaper00044057 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | cas6 | |||||||
| Other_name (23) | |||||||||
| HGVSg | CHROMOSOME_II:g.5938573G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F28B12 | |||||
| Flanking_sequences | acgaactaatcgctaggtatatcaaattgc | atgtggaaaaacgaggactcggaaacaagt | |||||||
| Mapping_target | F28B12 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00044057 | ||||
| SeqStatus | Sequenced | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | GOU | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001208 | |||||||
| Transcript (13) | |||||||||
| Interactor | WBInteraction000521284 | ||||||||
| Genetics | Interpolated_map_position | II | -0.817736 | ||||||
| Description | Phenotype | WBPhenotype:0000172 | Paper_evidence | WBPaper00044057 | |||||
| Curator_confirmed | WBPerson3772 | ||||||||
| Remark | Figure 5A, Q.ap and Q.paa performed one more round of cell division | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBbt:0003927 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBPhenotype:0000829 | Paper_evidence | WBPaper00044057 | |||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| Remark | Figure 5A, Q.ap and Q.paa performed one more round of cell division | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBbt:0003927 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00044057 | |||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| Remark | FLP cells expressed mec-4::gfp | Paper_evidence | WBPaper00044057 | ||||||
| Curator_confirmed | WBPerson3772 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006828 | PATO:0000460 | Paper_evidence | WBPaper00044057 | ||||
| Curator_confirmed | WBPerson3772 | ||||||||
| Phenotype_assay | Genotype | mec-4::gfp | Paper_evidence | WBPaper00044057 | |||||
| Curator_confirmed | WBPerson3772 | ||||||||
| Reference | WBPaper00044057 | ||||||||
| Method | Substitution_allele |
