WormBase Tree Display for Variation: WBVar02125140

WBVar02125140 Name: Public_name: tm6495
    HGVSg: CHROMOSOME_V:g.15068511_15068973del
  Sequence_details: SMap: S_parent: Sequence: C01G10
    Flanking_sequences: aaaacttcttgtgtttttgtttttttcgat gttctcagaaatgaagaaaaacgaaaagaa
    Mapping_target: C01G10
    Source_location: 7 CHROMOSOME_V 15068510 15068974 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6495_external
      tm6495_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6495
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00305285
      WBGene00007720
      WBGene00001021
    Transcript: C25D7.10.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 739-?
        Exon_number: 4/4
      C25D7.19
      C01G10.12.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-252
        CDS_position: ?-240
        Protein_position: ?-80
        Intron_number: 2/6
        Exon_number: 1-3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 514/515-977/978 (463 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele