WormBase Tree Display for Variation: WBVar02125152

WBVar02125152 Name: Public_name: tm6497
    Other_name: CE00122:p.Gly614_Tyr842delextTer?
      C50C3.6.1:c.1839_2525del
    HGVSg: CHROMOSOME_III:g.8166541_8167275del
  Sequence_details: SMap: S_parent: Sequence: C50C3
    Flanking_sequences: catctactatcgtttcaacactgggccggt cagtgtgaagaatagattgaatcaatccca
    Mapping_target: C50C3
    Source_location: 7 CHROMOSOME_III 8166541 8167275 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6497_external
      tm6497_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6497
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004187
    Transcript: C50C3.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 8354/8355-9087/9088 (733 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele