WormBase Tree Display for Variation: WBVar02125156

WBVar02125156 Name: Public_name: tm6513
    Other_name: Y11D7A.9.1:c.315_610-10del
    HGVSg: CHROMOSOME_IV:g.9254945_9255469del
  Sequence_details: SMap: S_parent: Sequence: Y11D7A
    Flanking_sequences: caagtagtatgataatcggccctgaaaaca aaaagttgccaaaacgtacgttcaactggt
    Mapping_target: Y11D7A
    Source_location: 7 CHROMOSOME_IV 9254944 9255470 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6513_external
      tm6513_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6513
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012433
    Transcript: Y11D7A.9.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y11D7A.9.1:c.315_610-10del
        cDNA_position: 333-?
        CDS_position: 315-?
        Protein_position: 105-?
        Intron_number: 4-6/9
        Exon_number: 4-6/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 27129/27130-27654/27655 (525 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele