WormBase Tree Display for Variation: WBVar02125195

WBVar02125195 Name: Public_name: tm6544
    Other_name: ZK593.6a.1:c.106+175_107-141del
    HGVSg: CHROMOSOME_IV:g.10935278_10935581del
  Sequence_details: SMap: S_parent: Sequence: ZK593
    Flanking_sequences: aagattggcgtacgttcagttttggttgtt ctgaccttttacaatggacgggtgaaggaa
    Mapping_target: ZK593
    Source_location: 7 CHROMOSOME_IV 10935277 10935582 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6544_external
      tm6544_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6544
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002981
    Transcript: ZK593.6a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: ZK593.6a.1:c.106+175_107-141del
        Intron_number: 2/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 25483/25484-25787/25788 (304 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele