WormBase Tree Display for Variation: WBVar02125202

WBVar02125202 Name: Public_name: tm6601
    Other_name: CE18021:p.Glu67GlyfsTer4
      K07H8.1.1:c.200_1062del
    HGVSg: CHROMOSOME_IV:g.8295152_8296096del
  Sequence_details: SMap: S_parent: Sequence: K07H8
    Flanking_sequences: atccaaatggaggatcattgatgaagcatg ggttggtttcaaaaatattaaaaattattt
    Mapping_target: K07H8
    Source_location: 7 CHROMOSOME_IV 8295151 8296097 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6601_external
      tm6601_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6601
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019503
    Transcript: K07H8.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 35777/35778-36722/36723 (945 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele