WormBase Tree Display for Variation: WBVar02125209
expand all nodes | collapse all nodes | view schema
WBVar02125209 | Name | Public_name | tm6621 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F13H8.10c.3:c.163-26_556del | |||||||
F13H8.10c.1:c.163-26_556del | ||||||||
F13H8.10b.1:c.385-26_778del | ||||||||
F13H8.10c.2:c.163-26_556del | ||||||||
F13H8.10a.1:c.2134-26_2527del | ||||||||
F13H8.10c.5:c.163-26_556del | ||||||||
F13H8.10c.4:c.163-26_556del | ||||||||
F13H8.10c.6:c.163-26_556del | ||||||||
HGVSg | CHROMOSOME_II:g.6277880_6278344del | |||||||
Sequence_details | SMap | S_parent | Sequence | F13H8 | ||||
Flanking_sequences | cggtgagaaaattaaatattgaacaaaaaa | tctctgatgcaacaactcaacaattgatag | ||||||
Mapping_target | F13H8 | |||||||
Source_location | 7 | CHROMOSOME_II | 6277879 | 6278345 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6621_external | |||||||
tm6621_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6621 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000259 | ||||||
Transcript | F13H8.10c.5 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10c.5:c.163-26_556del | |||||||
cDNA_position | ?-1735 | |||||||
CDS_position | ?-556 | |||||||
Protein_position | ?-186 | |||||||
Intron_number | 8-9/13 | |||||||
Exon_number | 9-10/14 | |||||||
F13H8.10c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10c.1:c.163-26_556del | |||||||
cDNA_position | ?-723 | |||||||
CDS_position | ?-556 | |||||||
Protein_position | ?-186 | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 4-5/9 | |||||||
F13H8.10c.6 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10c.6:c.163-26_556del | |||||||
cDNA_position | ?-803 | |||||||
CDS_position | ?-556 | |||||||
Protein_position | ?-186 | |||||||
Intron_number | 4-5/10 | |||||||
Exon_number | 5-6/11 | |||||||
F13H8.10c.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10c.2:c.163-26_556del | |||||||
cDNA_position | ?-642 | |||||||
CDS_position | ?-556 | |||||||
Protein_position | ?-186 | |||||||
Intron_number | 2-3/8 | |||||||
Exon_number | 3-4/9 | |||||||
F13H8.10b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10b.1:c.385-26_778del | |||||||
cDNA_position | ?-790 | |||||||
CDS_position | ?-778 | |||||||
Protein_position | ?-260 | |||||||
Intron_number | 3-4/9 | |||||||
Exon_number | 4-5/10 | |||||||
F13H8.10a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10a.1:c.2134-26_2527del | |||||||
cDNA_position | ?-2576 | |||||||
CDS_position | ?-2527 | |||||||
Protein_position | ?-843 | |||||||
Intron_number | 14-15/20 | |||||||
Exon_number | 15-16/21 | |||||||
F13H8.10c.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10c.3:c.163-26_556del | |||||||
cDNA_position | ?-2487 | |||||||
CDS_position | ?-556 | |||||||
Protein_position | ?-186 | |||||||
Intron_number | 13-14/19 | |||||||
Exon_number | 14-15/20 | |||||||
F13H8.10c.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13H8.10c.4:c.163-26_556del | |||||||
cDNA_position | ?-1960 | |||||||
CDS_position | ?-556 | |||||||
Protein_position | ?-186 | |||||||
Intron_number | 9-10/14 | |||||||
Exon_number | 10-11/15 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 24954/24955-25419/25420 (465 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |