WormBase Tree Display for Variation: WBVar02125213

WBVar02125213 Name: Public_name: tm6627
  Sequence_details: SMap: S_parent: Sequence: C35C5
    Flanking_sequences: aaattacaacacatattcacaacgtaaaag ttaaaaaataaatgcgaaaaatactacttt
    Mapping_target: C35C5
    Source_location: 7 CHROMOSOME_X 11555196 11555480 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GTTGAG
      Deletion
    PCR_product: tm6627_external
      tm6627_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6627
    NBP_allele
    Status: Live
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 26734/26735-GTTGAG-27017/27018 (283 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele