WormBase Tree Display for Variation: WBVar02125262

WBVar02125262 Name: Public_name: tm6599
    Other_name: K08F8.6.1:c.295_684-3delinsAAAA
    HGVSg: CHROMOSOME_II:g.8771537_8772021delinsAAAA
  Sequence_details: SMap: S_parent: Sequence: K08F8
    Flanking_sequences: acccccaactgataacaaagaaactccaaa gacatttggagtgcaaaacaaaacgtgttg
    Mapping_target: K08F8
    Source_location: 7 CHROMOSOME_II 8771535 8772023 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAAAAA
      Deletion
    PCR_product: tm6599_external
      tm6599_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6599
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002295
    Transcript: K08F8.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K08F8.6.1:c.295_684-3delinsAAAA
        cDNA_position: 396-?
        CDS_position: 294-?
        Protein_position: 98-?
        Intron_number: 4-5/21
        Exon_number: 4-5/22
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 33813/33814-AAAAAA-34300/34301 (487 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele