WormBase Tree Display for Variation: WBVar02125272

WBVar02125272 Name: Public_name: tm6637
    Other_name: CE10972:p.Phe42LeufsTer29
      F53F4.10.1:c.126_646delinsATTTAATTATTTTTT
    HGVSg: CHROMOSOME_V:g.13624814_13625424delinsAAAAAATAATTAAAT
  Sequence_details: SMap: S_parent: Sequence: F53F4
    Flanking_sequences: tttctttgagagaagtaagctctccgaatg aatttgacattcaaattattttctttagtg
    Mapping_target: F53F4
    Source_location: 7 CHROMOSOME_V 13624813 13625425 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAAAAATAATTAAAT
      Deletion
    PCR_product: tm6637_external
      tm6637_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6637
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00219552
      WBGene00009992
    Transcript: F53F4.25
      F53F4.10.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 40423/40424-AAAAAATAATTAAAT-41034/41035 (611 bp deletion + 15 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele