WormBase Tree Display for Variation: WBVar02125402
expand all nodes | collapse all nodes | view schema
WBVar02125402 | Name | Public_name | ok3307 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE45781:p.Lys470SerfsTer22 | ||||||
F25D1.4.1:c.1407_2184del | |||||||
HGVSg | CHROMOSOME_V:g.10544064_10544978del | ||||||
Sequence_details | SMap | S_parent | Sequence | F25D1 | |||
Flanking_sequences | ttttggagtttccgataatttccatgatgt | ttcagtgataaattttcaaatttctcgaaa | |||||
Mapping_target | F25D1 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK3307_external | ||||||
OK3307_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00037463 | ||||||
WBStrain00052617 | |||||||
WBStrain00054704 | |||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00009109 | |||||
Transcript | F25D1.4.1 (11) | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype_not_observed | WBPhenotype:0002069 | Paper_evidence | WBPaper00064137 | |||
Curator_confirmed | WBPerson557 | ||||||
Remark | Animals did not have a defect in the PLM neurons axon termination (no overextension). | Paper_evidence | WBPaper00064137 | ||||
Curator_confirmed | WBPerson557 | ||||||
Reference | WBPaper00061945 | ||||||
WBPaper00065804 | |||||||
WBPaper00064137 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |