WormBase Tree Display for Variation: WBVar02125504

WBVar02125504 Name: Public_name: tm6670
    Other_name: T08G3.3.1:c.323-265_800del
    HGVSg: CHROMOSOME_V:g.16459578_16460320del
  Sequence_details: SMap: S_parent: Sequence: T08G3
    Flanking_sequences: ttggtcaatcctacatccatatttccagaa agttagcatgtgaaagggaattaggcagga
    Mapping_target: T08G3
    Source_location: 7 CHROMOSOME_V 16459577 16460321 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6670_external
      tm6670_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6670
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00005359
    Transcript: T08G3.3.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T08G3.3.1:c.323-265_800del
        cDNA_position: ?-801
        CDS_position: ?-800
        Protein_position: ?-267
        Intron_number: 3/4
        Exon_number: 4/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal of sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal of sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 21163/21164-21906/21907 (743 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele