WormBase Tree Display for Variation: WBVar02125512

WBVar02125512 Name: Public_name: tm6668
    Other_name: T10H9.4.1:c.39_*246del
    HGVSg: CHROMOSOME_V:g.6655763_6656433del
  Sequence_details: SMap: S_parent: Sequence: T10H9
    Flanking_sequences: cctaaataaattaatttcagaaatggatga cttcctccctgtgcgccggcatctccttga
    Mapping_target: T10H9
    Source_location: 7 CHROMOSOME_V 6655762 6656434 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6668_external
      tm6668_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6668
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004897
    Transcript: T10H9.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T10H9.4.1:c.39_*246del
        cDNA_position: 69-606
        CDS_position: 39-?
        Protein_position: 13-?
        Intron_number: 2/3
        Exon_number: 2-4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 22539/22540-23210/23211 (671 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele