WormBase Tree Display for Variation: WBVar02125548

WBVar02125548 Name: Public_name: tm6700
    Other_name: ZC168.3a.1:c.144+29_1036-29del
    HGVSg: CHROMOSOME_IV:g.10733233_10734406del
  Sequence_details: SMap: S_parent: Sequence: ZC168
    Flanking_sequences: atctggaacctttggatgagaaatttttct tttgaaattgaagttgtaaaacacgaaccc
    Mapping_target: ZC168
    Source_location: 7 CHROMOSOME_IV 10733232 10734407 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6700_external
      tm6700_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6700
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013857
    Transcript: ZC168.3a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZC168.3a.1:c.144+29_1036-29del
        Intron_number: 2-7/9
        Exon_number: 3-7/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 14433/14434-15607/15608 (1174 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele