WormBase Tree Display for Variation: WBVar02125563

WBVar02125563 Name: Public_name: tm6701
    Other_name: AC3.6.1:c.301+160_865del
    HGVSg: CHROMOSOME_V:g.10393644_10394716del
  Sequence_details: SMap: S_parent: Sequence: AC3
    Flanking_sequences: tgtaattagaaaactcgtcagtttttcctc attttatttggcttatgttttactcaggaa
    Mapping_target: AC3
    Source_location: 7 CHROMOSOME_V 10393643 10394717 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6701_external
      tm6701_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6701
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00195634
      WBGene00000724
    Transcript: AC3.14 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      AC3.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: AC3.6.1:c.301+160_865del
        cDNA_position: ?-865
        CDS_position: ?-865
        Protein_position: ?-289
        Intron_number: 2-3/3
        Exon_number: 3-4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 30597/30598-31670/31671 (1073 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele