WormBase Tree Display for Variation: WBVar02125566

WBVar02125566 Name: Public_name: tm6741
    Other_name: CE02523:p.Ala38_Ter122delinsAsp
      C30B5.4.1:c.113_364del
    HGVSg: CHROMOSOME_II:g.6196399_6196823del
  Sequence_details: SMap: S_parent: Sequence: C30B5
    Flanking_sequences: gtttcgtttcatcatcggcatcttctttgt cagaatctttgtaagtttgatgccacgatt
    Mapping_target: C30B5
    Source_location: 7 CHROMOSOME_II 6196398 6196824 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6741_external
      tm6741_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6741
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016245
    Transcript: C30B5.4.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 5134/5135-5559/5560 (425 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele