WormBase Tree Display for Variation: WBVar02125567

WBVar02125567 Name: Public_name: tm6742
    Other_name: Y113G7A.3.1:c.139-245_381delinsC
    HGVSg: CHROMOSOME_V:g.20091913_20092504delinsC
  Sequence_details: SMap: S_parent: Sequence: Y113G7A
    Flanking_sequences: ccaattttgaacgctgctaaaactacaaact gccaccacaatgccgccgatcttcgttttc
    Mapping_target: Y113G7A
    Source_location: 7 CHROMOSOME_V 20091912 20092505 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: C
      Deletion
    PCR_product: tm6742_external
      tm6742_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6742
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004754
    Transcript: Y113G7A.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y113G7A.3.1:c.139-245_381delinsC
        cDNA_position: ?-386
        CDS_position: ?-381
        Protein_position: ?-127
        Intron_number: 2-4/13
        Exon_number: 3-5/14
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 65487/65488-C-66079/66080 (592 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele