WormBase Tree Display for Variation: WBVar02125583

WBVar02125583 Name: Public_name: tm6731
    Other_name: Y23H5A.4a.1:c.-11_321del
    HGVSg: CHROMOSOME_I:g.2617549_2617972del
  Sequence_details: SMap: S_parent: Sequence: Y23H5A
    Flanking_sequences: ttttgaatttttcacaagctagcaaagtag tatgtgagtttcgaattccactacgtggtc
    Mapping_target: Y23H5A
    Source_location: 7 CHROMOSOME_I 2617548 2617973 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6731_external
      tm6731_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6731
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021271
    Transcript: Y23H5A.4a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y23H5A.4a.1:c.-11_321del
        cDNA_position: 21-352
        CDS_position: ?-321
        Protein_position: ?-107
        Intron_number: 2-3/7
        Exon_number: 1-4/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 10855/10856-11279/11280 (424 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele