WormBase Tree Display for Variation: WBVar02125596

WBVar02125596 Name: Public_name: tm6756
    Other_name: C01B10.8.1:c.751_1252+94del
    HGVSg: CHROMOSOME_IV:g.6636251_6636984del
  Sequence_details: SMap: S_parent: Sequence: C01B10
    Flanking_sequences: caggagctctcacaattcatctacctgtgc atttgaaaattgcagtattgtttaaaggcg
    Mapping_target: C01B10
    Source_location: 7 CHROMOSOME_IV 6636250 6636985 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6756_external
      tm6756_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6756
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015282
    Transcript: C01B10.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C01B10.8.1:c.751_1252+94del
        cDNA_position: 754-?
        CDS_position: 751-?
        Protein_position: 251-?
        Intron_number: 6-9/13
        Exon_number: 6-9/14
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 22417/22418-23151/23152 (734 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele