WormBase Tree Display for Variation: WBVar02125626

WBVar02125626 Name: Public_name: tm6792
    Other_name: CE16802:p.Pro230ArgfsTer16
      C02B10.5a.1:c.689_1091del
      C02B10.5a.2:c.689_1091del
      C02B10.5b.1:c.377_779del
      CE49438:p.Pro126ArgfsTer16
    HGVSg: CHROMOSOME_IV:g.5084826_5085275del
  Sequence_details: SMap: S_parent: Sequence: C02B10
    Flanking_sequences: ttatgtcatcagcggcgtcttcatcaactc gtcagtcggagaagagtttgctcaacaagc
    Mapping_target: C02B10
    Source_location: 7 CHROMOSOME_IV 5084825 5085276 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6792_external
      tm6792_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6792
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015330
    Transcript: C02B10.5a.2 (11)
      C02B10.5a.1 (11)
      C02B10.5b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 13993/13994-14443/14444 (450 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele