WormBase Tree Display for Variation: WBVar02125746
expand all nodes | collapse all nodes | view schema
| WBVar02125746 | Evidence | Paper_evidence | WBPaper00045315 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | aus3 | |||||||
| Other_name | CE32158:p.Gln681Ter | ||||||||
| C34E10.8.1:c.2041C>T | |||||||||
| HGVSg | CHROMOSOME_III:g.5250588G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C34E10 | |||||
| Flanking_sequences | caaggatctatgatgccagtagcaatgaat | agagccctcaagctgttcggcgacaaactc | |||||||
| Mapping_target | C34E10 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00045315 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | HRN | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00016409 | |||||||
| Transcript | C34E10.8.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C34E10.8.1:c.2041C>T | ||||||||
| HGVSp | CE32158:p.Gln681Ter | ||||||||
| cDNA_position | 2042 | ||||||||
| CDS_position | 2041 | ||||||||
| Protein_position | 681 | ||||||||
| Exon_number | 16/21 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000521947 | ||||||||
| WBInteraction000523931 | |||||||||
| Genetics | Interpolated_map_position | III | -1.85646 | ||||||
| Description | Phenotype | WBPhenotype:0000699 | Paper_evidence | WBPaper00045315 | |||||
| Curator_confirmed | WBPerson10402 | ||||||||
| Remark | Suppresses synthetic multivulva phenotype of lin-15AB(n765) double mutants | Paper_evidence | WBPaper00045315 | ||||||
| Curator_confirmed | WBPerson10402 | ||||||||
| WBPhenotype:0001236 | Paper_evidence | WBPaper00045315 | |||||||
| Curator_confirmed | WBPerson10402 | ||||||||
| Remark | Hypodermal expression level of CTBP-1::GFP is increased in sumv-1(aus3) mutant animals | Paper_evidence | WBPaper00045315 | ||||||
| Curator_confirmed | WBPerson10402 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00045315 | ||||
| Curator_confirmed | WBPerson10402 | ||||||||
| Phenotype_assay | Genotype | CTBP-1::GFP | Paper_evidence | WBPaper00045315 | |||||
| Curator_confirmed | WBPerson10402 | ||||||||
| Reference | WBPaper00045315 | ||||||||
| Method | Substitution_allele |
