WormBase Tree Display for Variation: WBVar02141102
expand all nodes | collapse all nodes | view schema
WBVar02141102 | Name | Public_name | tm6807 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C55A6.7.1:c.442_*26del | |||||||
HGVSg | CHROMOSOME_V:g.11519458_11519845del | |||||||
Sequence_details | SMap | S_parent | Sequence | C55A6 | ||||
Flanking_sequences | tgaaagtaaatcagtcgtacaacaatcatt | gattgcaccacgagaaacggaaagtgtatc | ||||||
Mapping_target | C55A6 | |||||||
Source_location | 7 | CHROMOSOME_V | 11519457 | 11519846 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6807_external | |||||||
tm6807_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6807 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008336 | ||||||
Transcript | C55A6.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C55A6.7.1:c.442_*26del | |||||||
cDNA_position | 539-879 | |||||||
CDS_position | 442-? | |||||||
Protein_position | 148-? | |||||||
Intron_number | 3/4 | |||||||
Exon_number | 3-5/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | extended lifespan upon exposure to S. maltophilia K279a | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | NO lifespan phenotype upon exposure to E. coli OP50 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00059839 | |||||||
Remark | 22065/22066-22453/22454 (388 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |