WormBase Tree Display for Variation: WBVar02141129

WBVar02141129 Name: Public_name: tm6848
    Other_name: C16D9.2.1:c.3870-15_4905delinsCCCTTAATGCGTATTTCT
    HGVSg: CHROMOSOME_V:g.8231891_8232941delinsAGAAATACGCATTAAGGG
  Sequence_details: SMap: S_parent: Sequence: C16D9
    Flanking_sequences: tagcagcatccaggtgagagatatgagtag gcattaagggttttaatagtttgaacttac
    Mapping_target: C16D9
    Source_location: 7 CHROMOSOME_V 8231889 8232942 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CAGAAATACGCATTAAGGG
      Deletion
    PCR_product: tm6848_external
      tm6848_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6848
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004395
    Transcript: C16D9.2.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C16D9.2.1:c.3870-15_4905delinsCCCTTAATGCGTATTTCT
        cDNA_position: ?-4964
        CDS_position: ?-4906
        Protein_position: ?-1636
        Intron_number: 20/29
        Exon_number: 21/30
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 3401/3402-CAGAAATACGCATTAAGGG-4453/4454 (1052 bp deletion + 19 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele