WormBase Tree Display for Variation: WBVar02141186

WBVar02141186 Name: Public_name: tm6895
    HGVSg: CHROMOSOME_I:g.1701088_1701569delinsAAACTATTTTTTTTACTTATTT
  Sequence_details: SMap: S_parent: Sequence: Y71G12B
    Flanking_sequences: cacacacacaggctgatcacagtgcacttt tttttcagatatatgaacatcgcgctcgaa
    Mapping_target: Y71G12B
    Source_location: 7 CHROMOSOME_I 1701087 1701570 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAACTATTTTTTTTACTTATTT
      Deletion
    PCR_product: tm6895_external
      tm6895_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6895
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006702
      WBGene00003080
    Transcript: Y71G12B.14.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/3
        Exon_number: 1-2/4
      Y71G12B.15a.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1035-?
        Exon_number: 5/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as Emb by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 60660/60661-AAACTATTTTTTTTACTTATTT-61142/61143 (482 bp deletion + 22 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele