WormBase Tree Display for Variation: WBVar02143900

WBVar02143900 Name: Public_name: tm6985
    Other_name: CE24124:p.Leu32TyrfsTer9
      Y110A7A.4.1:c.95_447del
    HGVSg: CHROMOSOME_I:g.5138364_5138760del
  Sequence_details: SMap: S_parent: Sequence: Y110A7A
    Flanking_sequences: ttcacttgaatcaagatgaatataaatatt acagattactctggacaaggtgttgatcag
    Mapping_target: Y110A7A
    Source_location: 7 CHROMOSOME_I 5138363 5138761 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6985_external
      tm6985_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6985
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022455
    Transcript: Y110A7A.4.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 37728/37729-38125/38126 (397 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele