WormBase Tree Display for Variation: WBVar02143989

WBVar02143989 Name: Public_name: tm7127
    Other_name: C35A5.9.1:c.237-85_352del
    HGVSg: CHROMOSOME_V:g.10526726_10526972del
  Sequence_details: SMap: S_parent: Sequence: C35A5
    Flanking_sequences: aaattgaaagaaaataattaagctcataac aagccggtggaacagttttagctgccaatt
    Mapping_target: C35A5
    Source_location: 7 CHROMOSOME_V 10526725 10526973 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7127_external
      tm7127_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7127
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007953
    Transcript: C35A5.9.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C35A5.9.1:c.237-85_352del
        cDNA_position: ?-478
        CDS_position: ?-352
        Protein_position: ?-118
        Intron_number: 3-4/9
        Exon_number: 4-5/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 39057/39058-39304/39305 (247 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele