WormBase Tree Display for Variation: WBVar02144447

WBVar02144447 Evidence: Paper_evidence: WBPaper00046863
  Name: Public_name: et19
    Other_name: W10D5.2.1:c.580C>T
      W10D5.2.2:c.580C>T
      CE14780:p.Gln194Ter
    HGVSg: CHROMOSOME_I:g.9108458G>A
  Sequence_details: SMap: S_parent: Sequence: W10D5
    Flanking_sequences: caaaagaagatcaagcgtaagcgagaagct aactttggtacagacgctaaacagaacacg
    Mapping_target: W10D5
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00046863
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031178
    Laboratory: QC
    Status: Live
  Affects: Gene: WBGene00012376
    Transcript: W10D5.2.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: W10D5.2.2:c.580C>T
        HGVSp: CE14780:p.Gln194Ter
        cDNA_position: 822
        CDS_position: 580
        Protein_position: 194
        Exon_number: 5/6
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      W10D5.2.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: W10D5.2.1:c.580C>T
        HGVSp: CE14780:p.Gln194Ter
        cDNA_position: 580
        CDS_position: 580
        Protein_position: 194
        Exon_number: 4/5
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000532874
      WBInteraction000537436
      WBInteraction000537437
      WBInteraction000537438
      WBInteraction000537444
      WBInteraction000537445
      WBInteraction000537447
      WBInteraction000537449
      WBInteraction000537450
  Genetics: Interpolated_map_position: I 3.57298
  Description: Phenotype: WBPhenotype:0000061 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: "Similarly, the nduf-7(et19) mutant has a low respiration rate, indicative of a compromised ETC function, as well as an extended lifespan (Figure 6, A and B)." Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0007568 PATO:0000460 Paper_evidence: WBPaper00046863
                Curator_confirmed: WBPerson2987
      WBPhenotype:0001236 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: "We therefore hypothesized that the et19 mutant may also be resistant to statins because of an activated mitochondrial stress response. Consistent with this hypothesis, et19 mutant worms constitutively express high levels of hsp-60::GFP, a known marker of UPRmt (Figure 2D) (Yoneda et al. 2004; Rauthan et al. 2013)." Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0034514 PATO:0000460 Paper_evidence: WBPaper00046863
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: hsp-60::GFP Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001502 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: "The et19 mutant allele was isolated in a forward genetic screen for mutants surviving on 0.5 mM fluvastatin plates (Figure 1B, Figure 2A)." Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
          "The et19 mutant worms are resistant to rosuvastatin (another class of statin), indicating that they have a generic resistance to statins rather than to one particular subtype (Figure 2C)." Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00003950 Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
            WBMol:00002377 Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
      WBPhenotype:0002163 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: "Similarly, the nduf-7(et19) mutant has a low respiration rate, indicative of a compromised ETC function, as well as an extended lifespan (Figure 6, A and B)." Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0009060 PATO:0000460 Paper_evidence: WBPaper00046863
                Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000306 Paper_evidence: WBPaper00046863
        Curator_confirmed: WBPerson2987
        Remark: "The stress response is specific for mitochondria because neither the knockdown of nduf-7 nor the nduf-7(et19) allele causes activation hsp-4::GFP, a reporter of the unfolded protein response in the endoplasmic reticulum (UPRer) (Kapulkin et al. 2005)." Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0030968 PATO:0000460 Paper_evidence: WBPaper00046863
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: hsp-4::GFP Paper_evidence: WBPaper00046863
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00046863
  Method: Substitution_allele