WormBase Tree Display for Variation: WBVar02145120

WBVar02145120 Name: Public_name: tm7939
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_III
    Flanking_sequences: acttcaacgtgtttcaaagcgaaatgtgta acgagcgaaatcggtgaaaaaaatcggttt
    Mapping_target: CHROMOSOME_III
    Source_location: 7 CHROMOSOME_III 9003576 9054508 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7939_external
      tm7939_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7939
    NBP_allele
    Status: Live
  Affects: Gene (18)
    Transcript (24)
    Pseudogene: F59B2.11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: [F59B2]10547/10548-[R107]22721/22722 (50931 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F59B2 updated based on the VEP analysis pipeline to CHROMOSOME_III.
  Method: NBP_knockout_allele