WormBase Tree Display for Variation: WBVar02146355
expand all nodes | collapse all nodes | view schema
WBVar02146355 | Evidence | Paper_evidence | WBPaper00048724 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | qm150sea3 | |||||
Other_name | CE17071:p.Arg148His | ||||||
F42G8.12.1:c.443G>A | |||||||
HGVSg | CHROMOSOME_IV:g.8135200C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F42G8 | |||
Flanking_sequences | aatttttccaggctatggcagctgatcaac | tgccttggcttcgatcgaaatcaacatggc | |||||
Mapping_target | F42G8 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00048724 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | KAE | ||||||
Status | Live | ||||||
Linked_to | WBVar00241264 | ||||||
Affects | Gene | WBGene00002162 | |||||
Transcript | F42G8.12.1 (12) | ||||||
Interactor | WBInteraction000536187 | ||||||
Genetics | Interpolated_map_position | IV | 3.62265 | ||||
Description | Phenotype | WBPhenotype:0000676 | Paper_evidence | WBPaper00048724 | |||
Curator_confirmed | WBPerson3376 | ||||||
Remark | The sea3 allele is an intragenic suppressor of the isp-1(qm150) slow development phenotype | Paper_evidence | WBPaper00048724 | ||||
Curator_confirmed | WBPerson3376 | ||||||
Reference | WBPaper00048724 | ||||||
Remark | Intragenic suppressor of isp-1(qm150) | Paper_evidence | WBPaper00048724 | ||||
Method | Substitution_allele |