WormBase Tree Display for Variation: WBVar02146372
expand all nodes | collapse all nodes | view schema
| WBVar02146372 | Evidence | Paper_evidence | WBPaper00049562 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n5823 | |||||
| Other_name | ZK593.8.1:c.862_869del | ||||||
| CE28722:p.Glu288AsnfsTer10 | |||||||
| HGVSg | CHROMOSOME_IV:g.10939085_10939092del | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZK593 | |||
| Flanking_sequences | ttatcacttggacaaactcgtgcaatactc | aatggttattcccggaaaaagtattcgtgaa | |||||
| Mapping_target | ZK593 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Engineered_allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | MT | ||||||
| Production_method | CRISPR_Cas9 | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00014004 | |||||
| Transcript | ZK593.8.1 | VEP_consequence | frameshift_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | ZK593.8.1:c.862_869del | ||||||
| HGVSp | CE28722:p.Glu288AsnfsTer10 | ||||||
| cDNA_position | 880-887 | ||||||
| CDS_position | 862-869 | ||||||
| Protein_position | 288-290 | ||||||
| Exon_number | 6/8 | ||||||
| Codon_change | GAATCAGGa/a | ||||||
| Amino_acid_change | ESG/X | ||||||
| Interactor | WBInteraction000535398 | ||||||
| Description | Phenotype | WBPhenotype:0002164 | Paper_evidence | WBPaper00049562 | |||
| Curator_confirmed | WBPerson33753 | ||||||
| Remark | animals are more susceptible to PA14 infection | Paper_evidence | WBPaper00049562 | ||||
| Curator_confirmed | WBPerson33753 | ||||||
| Phenotype_not_observed | WBPhenotype:0001574 | Paper_evidence | WBPaper00061504 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Neither fic-1 knock-out worms nor worms expressing low or high levels of the constitutive AMPylase FIC-1(E274G) show significant differences in ATP levels compared to N2 controls (Fig. 1B). | Paper_evidence | WBPaper00061504 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00049562 | ||||||
| WBPaper00061504 | |||||||
| Method | Engineered_allele |
