WormBase Tree Display for Variation: WBVar02146399
expand all nodes | collapse all nodes | view schema
WBVar02146399 | Evidence | Paper_evidence | WBPaper00048406 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | qx322 | |||||||
Other_name | CE30707:p.Lys99Ter | ||||||||
Y110A7A.5.1:c.295A>T | |||||||||
HGVSg | CHROMOSOME_I:g.5135227A>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y110A7A | |||||
Flanking_sequences | aaagttggtagaaagacgacgagtgttgcc | aacgaggcgatgataattatggattcacaa | |||||||
Mapping_target | Y110A7A | ||||||||
Type_of_mutation | Substitution | a | t | Paper_evidence | WBPaper00048406 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | XW | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00305663 | |||||||
WBGene00003475 | |||||||||
Transcript | Y110A7A.25 | ||||||||
Y110A7A.5.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y110A7A.5.1:c.295A>T | ||||||||
HGVSp | CE30707:p.Lys99Ter | ||||||||
cDNA_position | 323 | ||||||||
CDS_position | 295 | ||||||||
Protein_position | 99 | ||||||||
Exon_number | 5/13 | ||||||||
Codon_change | Aaa/Taa | ||||||||
Amino_acid_change | K/* | ||||||||
Interactor | WBInteraction000535522 | ||||||||
WBInteraction000535523 | |||||||||
WBInteraction000535524 | |||||||||
Genetics | Interpolated_map_position | I | -0.38127 | ||||||
Description | Phenotype | WBPhenotype:0000679 | Paper_evidence | WBPaper00048406 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In wild-type sheath cells, 2xFYVE formed small puncta in the cytosol but was absent from the cell surface (Fig 5 L). In mtm-1(qx322), however, YFP::2xFYVE appeared on the surface of sheath cells, similar to PLCδ1-PH, which labels plasma membranes (Fig 5, K-K2', M, and N). This suggests that PtdIns3P accumulates on the cell surface in mtm-1(lf) sheath cells. Endosomal and phagosomal labeling by YFP::2xFYVE were also seen in mtm-1(qx322) when images were taken at the top focal plane because of the extremely thin cytosol of the sheath cell layer (Fig 5, M and N, arrowheads)." | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"LST-4::GFP was diffuse in the cytoplasm of wild-type sheath cells but appeared on plasma membranes in mtm-1(lf) worms, which accumulate both PtdIns(4,5)P2 and PtdIns3P on their cell membranes (Fig 5, K-N; and Fig S5, B-D)." | Paper_evidence | WBPaper00048406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00021164 | ||||||||
EQ_annotations | GO_term | GO:0009986 | PATO:0000460 | Paper_evidence | WBPaper00048406 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Molecule_affected | WBMol:00004725 | PATO:0000460 | Paper_evidence | WBPaper00048406 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | YFP::2xFYVE | Paper_evidence | WBPaper00048406 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
LST-4::GFP | Paper_evidence | WBPaper00048406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001180 | Paper_evidence | WBPaper00048406 | |||||||
Curator_confirmed | WBPerson17560 | ||||||||
Remark | "qx322 worms contained significantly more germ cell corpses than the wild type (Fig S2 J)... Expression of wild-type, but not catalytically inactive, MTM-1 significantly reduced germ cell corpses in qx322 and gk890934, indicating that phosphatase activity is important for MTM-1 function in apoptotic cell clearance (Fig S2 K)." (Table S1) | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson17560 | ||||||||
Rescued_by_transgene | WBTransgene00021164 | ||||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00048406 | |||||||
Curator_confirmed | WBPerson17560 | ||||||||
Remark | "In mtm-1(qx322) or mtm-1 RNAi worms, almost all germ cell corpses were labeled by YFP::2xFYVE, whereas <50% of them were YFP positive in wild type (Fig 5, A-C' and G). Moreover, extending pseudopods, which are positive for PLCδ1-PH and MTM-1(C378S) but not 2xFYVE in wild type, were labeled by YFP::2xFYVE in mtm- 1(lf) (Fig 5, H and J; Fig S3, K-K''; and Video 6)." | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson17560 | ||||||||
Reference | WBPaper00048406 | ||||||||
Method | Substitution_allele |