WormBase Tree Display for Variation: WBVar02146663

WBVar02146663 Name: Public_name: tm8341
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_IV
    Flanking_sequences: aatcaacaacgttgacttgtcccttcatag gaaccaaacgttcgtaacgatataaattcg
    Mapping_target: CHROMOSOME_IV
    Source_location: 7 CHROMOSOME_IV 13234628 13271150 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm8341_external
      tm8341_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8341
    NBP_allele
    Status: Live
  Affects: Gene (13)
    Transcript (23)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [JC8]8666/8667-[Y67H2A]5738/5739 (36521 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target JC8 updated based on the VEP analysis pipeline to CHROMOSOME_IV.
  Method: NBP_knockout_allele