WormBase Tree Display for Variation: WBVar02146843

WBVar02146843 Name: Public_name: tm8652
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_I
    Flanking_sequences: ggtatcagttgtgaaggagtgggcaaaacg ttcaattgttattattgcccaacaaaaatc
    Mapping_target: CHROMOSOME_I
    Source_location: 7 CHROMOSOME_I 6383566 6405783 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm8652_external
      tm8652_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8652
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00303104
      WBGene00022591
      WBGene00197941
      WBGene00196705
      WBGene00022592
      WBGene00001596
    Transcript (13)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [ZC308]16568/16569-[ZC328]19425/19426 (22216 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target ZC308 updated based on the VEP analysis pipeline to CHROMOSOME_I.
  Method: NBP_knockout_allele