WormBase Tree Display for Variation: WBVar02146857

WBVar02146857 Name: Public_name: tm8670
    Other_name: C50E3.10.1:c.180+23_334del
    HGVSg: CHROMOSOME_V:g.7601116_7601341del
  Sequence_details: SMap: S_parent: Sequence: C50E3
    Flanking_sequences: tagaactaagagcatcgtgagaatctttat atcataaagcttataaatttaccaattttt
    Mapping_target: C50E3
    Source_location: 7 CHROMOSOME_V 7601115 7601342 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm8670_external
      tm8670_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8670
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016821
    Transcript: C50E3.10.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C50E3.10.1:c.180+23_334del
        cDNA_position: ?-334
        CDS_position: ?-334
        Protein_position: ?-112
        Intron_number: 1-2/3
        Exon_number: 2-3/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 13648/13649-13874/13875 (226 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele