WormBase Tree Display for Variation: WBVar02146858

WBVar02146858 Name: Public_name: tm8672
    Other_name: T22B7.5.1:c.-8+634_-8+748delinsCAT
    HGVSg: CHROMOSOME_X:g.5647087_5647201delinsATG
  Sequence_details: SMap: S_parent: Sequence: T22B7
    Flanking_sequences: tttatctagcgtttgcaaatctttttgata tgaaatagtccgatgtggcaagtacgtcat
    Mapping_target: T22B7
    Source_location: 7 CHROMOSOME_X 5647086 5647202 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ATG
      Deletion
    PCR_product: tm8672_external
      tm8672_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8672
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00005718
    Transcript: T22B7.5.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: T22B7.5.1:c.-8+634_-8+748delinsCAT
        Intron_number: 1/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 12900/12901-ATG-13015/13016 (115 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele