WormBase Tree Display for Variation: WBVar02147044

WBVar02147044 Name: Public_name: tm8850
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_III
    Flanking_sequences: caaatttgaatatttcttgcccgcatactc tcctccgtcgtcgctgtcgtcgttgtcgtt
    Mapping_target: CHROMOSOME_III
    Source_location: 7 CHROMOSOME_III 8477981 8511861 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm8850_external
      tm8850_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8850
    NBP_allele
    Status: Live
  Affects: Gene (17)
    Transcript (26)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [F42H10]5041/5042-[ZC21]198/199 (33879 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F42H10 updated based on the VEP analysis pipeline to CHROMOSOME_III.
  Method: NBP_knockout_allele