WormBase Tree Display for Variation: WBVar02147113

WBVar02147113 Name: Public_name: tm8936
    Other_name: C44B11.3.1:c.4-149_227-427delinsT
    HGVSg: CHROMOSOME_III:g.3135552_3137898delinsA
  Sequence_details: SMap: S_parent: Sequence: C44B11
    Flanking_sequences: tttggtaattttgccttttcagtaaaacac tagttttcgcggtgggacccagttttctca
    Mapping_target: C44B11
    Source_location: 7 CHROMOSOME_III 3135551 3137899 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm8936_external
      tm8936_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8936
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003175
    Transcript: C44B11.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C44B11.3.1:c.4-149_227-427delinsT
        Intron_number: 2-3/6
        Exon_number: 3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 3957/3958-A-6304/6305 (2347 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele