WormBase Tree Display for Variation: WBVar02147375
expand all nodes | collapse all nodes | view schema
WBVar02147375 | Evidence | Paper_evidence | WBPaper00050480 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | lq132 | |||||||
Other_name | F42A10.2b.1:c.927+1G>A | ||||||||
F42A10.2c.1:c.927+1G>A | |||||||||
F42A10.2a.1:c.927+1G>A | |||||||||
HGVSg | CHROMOSOME_III:g.6161405G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F42A10 | |||||
Flanking_sequences | ttaaggaggaggcagccagacacgttagag | tatgtgtcttttatagtagggcaacttgaa | |||||||
Mapping_target | F42A10 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00050480 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00054852 | ||||||||
Laboratory | LE | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003593 | |||||||
Transcript | F42A10.2c.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F42A10.2c.1:c.927+1G>A | ||||||||
Intron_number | 5/10 | ||||||||
F42A10.2b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F42A10.2b.1:c.927+1G>A | ||||||||
Intron_number | 6/13 | ||||||||
F42A10.2a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F42A10.2a.1:c.927+1G>A | ||||||||
Intron_number | 6/12 | ||||||||
Interactor | WBInteraction000537349 | ||||||||
WBInteraction000537350 | |||||||||
WBInteraction000537351 | |||||||||
WBInteraction000537352 | |||||||||
Genetics | Interpolated_map_position | III | -1.41221 | ||||||
Description | Phenotype | WBPhenotype:0000469 | Paper_evidence | WBPaper00050480 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | This defect was not observed in the weaker nfm-1(lq132) mutant, although more subtle defects in migration might have escaped detection. | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00023701 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0003927 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000533 | Paper_evidence | WBPaper00050480 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Q-cell protrusions at 1-2.5 hr were significantly shorter than in wild type (Figure 3, C-F). | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00023701 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008598 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001140 | Paper_evidence | WBPaper00050480 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | One line of Pmyo-3::nfm-1(+)::gfp also rescued AQR and PQR defects of nfm-1(lq132) (Figure 6D). | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003927 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No defects were observed in the direction of protrusion. Despite reduced protrusions in nfm-1 mutants, the Q cells completed their anterior and posterior migrations before division (n > 20 for both ok754 and lq132). | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008598 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00050480 | ||||||||
Method | Substitution_allele |