WormBase Tree Display for Variation: WBVar02147751

WBVar02147751 Name: Public_name: tm4149
    Other_name: CE30636:p.Leu29_Ter243delinsPhe
      C56C10.1.1:c.87_728del
      C56C10.12.1:c.4790-1021_4790-280del
    HGVSg: CHROMOSOME_II:g.6601410_6602151del
  Sequence_details: SMap: S_parent: Sequence: C56C10
    Flanking_sequences: ggttatgcaaagggaattcatacattattt tgaattttttaccattgattgtgggaagct
    Mapping_target: C56C10
    Source_location: 7 CHROMOSOME_II 6601409 6602152 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4149_external
      tm4149_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4149
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016968
      WBGene00016960
    Transcript: C56C10.12.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: C56C10.12.1:c.4790-1021_4790-280del
        Intron_number: 17/24
      C56C10.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 27123/27124-27865/27866 (742 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele