WormBase Tree Display for Variation: WBVar02148337
expand all nodes | collapse all nodes | view schema
WBVar02148337 | Name | Public_name | tm10597 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | tttgtttcgcacaaataattactatttata | ctacgcttaaattcatcacaaatttgtttc | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 7 | CHROMOSOME_II | 505689 | 544067 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm10597_external | |||||||
tm10597_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 10597 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020836 | ||||||
WBGene00020835 | ||||||||
WBGene00198619 | ||||||||
WBGene00003106 | ||||||||
WBGene00005512 | ||||||||
WBGene00196035 | ||||||||
WBGene00005324 | ||||||||
WBGene00020837 | ||||||||
WBGene00020834 | ||||||||
Transcript (14) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | [T27A1]2672/2673-[C09E8]1626/1627 (38377 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target T27A1 updated based on the VEP analysis pipeline to CHROMOSOME_II. | ||||||||
Method | NBP_knockout_allele |