WormBase Tree Display for Variation: WBVar02149829
expand all nodes | collapse all nodes | view schema
| WBVar02149829 | Evidence | Paper_evidence | WBPaper00055004 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | qx245 | |||||
| Other_name | CE28601:p.Gly119Glu | ||||||
| K10C9.3.1:c.356G>A | |||||||
| HGVSg | CHROMOSOME_V:g.1062008G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | K10C9 | |||
| Flanking_sequences | CCTTCTGGAAACACGAGTATGATAAGCACG | GACATGTGCTCAAAGTGAGAAGCTCTTCGA | |||||
| Mapping_target | K10C9 | ||||||
| Type_of_mutation | Substitution | G | A | Person_evidence | WBPerson3997 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | XW | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00019624 | |||||
| Transcript | K10C9.3.1 (12) | ||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Interpolated_map_position | V | -19.8561 | ||||
| Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00055004 | |||
| Curator_confirmed | WBPerson3997 | ||||||
| WBPhenotype:0000059 | Paper_evidence | WBPaper00055004 | |||||
| Curator_confirmed | WBPerson3997 | ||||||
| Reference | WBPaper00055004 | ||||||
| Remark | Created in the nameserver by Chris Grove | ||||||
| WBPaper00055004, allele of rnst-2 | |||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00019624 Missense 119 G119E | Person_evidence | WBPerson3997 | |||||
| Method | Substitution_allele |
