WormBase Tree Display for Variation: WBVar02149837
expand all nodes | collapse all nodes | view schema
WBVar02149837 | Evidence | Paper_evidence | WBPaper00056625 | ||||
---|---|---|---|---|---|---|---|
Person_evidence | WBPerson22699 | ||||||
Name | Public_name | me101 | |||||
Other_name | Y43C5A.6c.1:c.236G>A | ||||||
CE25285:p.Arg74His | |||||||
CE48196:p.Arg79His | |||||||
Y43C5A.6b.1:c.221G>A | |||||||
Y43C5A.6a.1:c.335G>A | |||||||
CE29064:p.Arg112His | |||||||
HGVSg | CHROMOSOME_IV:g.10283785C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y43C5A | |||
Flanking_sequences | tcactaattcctttgacatttcggagttcg | gtcttgtagtaaatgccagcgattcgtatg | |||||
Mapping_target | Y43C5A | ||||||
Type_of_mutation | Substitution | c | t | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00048041 | ||||||
Laboratory | AV | ||||||
Person | WBPerson22699 | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004297 | |||||
Transcript | Y43C5A.6c.1 (12) | ||||||
Y43C5A.6a.1 (12) | |||||||
Y43C5A.6b.1 (12) | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | IV | 4.5675 | ||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00056625 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | 100% of eggs laid by me101 mutant hermaphrodites are inviable. | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014793 | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001372 | Paper_evidence | WBPaper00056625 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | no RAD-51 foci were observed in the gonads of me101 mutants (Fig 1C) | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014793 | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001824 | Paper_evidence | WBPaper00056625 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | late pachytene me101 mutant meiocytes failed to form the six GFP::COSA-1 foci observed in wild-type late pachytene meiocytes | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014793 | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002012 | Paper_evidence | WBPaper00056625 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | We also observed structural defects ranging from chromosome fragmentation to the formation of chromosome aggregates in me101 diakinesis-stage oocytes | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014793 | Paper_evidence | WBPaper00056625 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00056625 | ||||||
Remark | Created in the nameserver by Karen Yook | ||||||
WBPaper00056625 rad-51 | |||||||
alt_det = c to t mut_det = R(112)H | |||||||
Method | Substitution_allele |