WormBase Tree Display for Variation: WBVar02151665
expand all nodes | collapse all nodes | view schema
WBVar02151665 | Name | Public_name | tm11327 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | atggataacccagactagatacttttaaaa | aaagagatagagatggagaaagagacgtcc | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 7 | CHROMOSOME_III | 8782742 | 8800041 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TAA | ||||||
Deletion | ||||||||
PCR_product | tm11327_external | |||||||
tm11327_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11327 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00269391 | ||||||
WBGene00018833 | ||||||||
WBGene00219329 | ||||||||
WBGene00219968 | ||||||||
WBGene00219701 | ||||||||
WBGene00006975 | ||||||||
WBGene00165303 | ||||||||
WBGene00305450 | ||||||||
Transcript | F54F2.15 | |||||||
F54F2.2a.6 | ||||||||
F54F2.2a.7 | ||||||||
F54F2.12 | ||||||||
F54F2.2a.1 | ||||||||
F54F2.2a.4 | ||||||||
K02D10.6 | ||||||||
F54F2.2a.2 | ||||||||
F54F2.2b.1 | ||||||||
F54F2.2a.3 | ||||||||
F54F2.13 | ||||||||
F54F2.2c.1 | ||||||||
F54F2.14.1 | ||||||||
K02D10.8.1 | ||||||||
F54F2.2a.5 | ||||||||
F54F2.5.1 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Remark | [K02D10]13985/13986-TAA-[F54F2]12800/12801 (17298 bp deletion + 3 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target K02D10 updated based on the VEP analysis pipeline to CHROMOSOME_III. | ||||||||
Method | NBP_knockout_allele |