WormBase Tree Display for Variation: WBVar02152010

WBVar02152010 Name: Public_name: tm11689
    Other_name: Y54G2A.25a.1:c.2888-39_2965del
    HGVSg: CHROMOSOME_IV:g.2966496_2966612del
  Sequence_details: SMap: S_parent: Sequence: Y54G2A
    Flanking_sequences: cggcccgggtctcggcccaaaccgatacct gcctgcttgccaaaaacctgcagctgaaat
    Mapping_target: Y54G2A
    Source_location: 7 CHROMOSOME_IV 2966495 2966613 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11689_external
      tm11689_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11689
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002243
    Transcript: Y54G2A.25a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y54G2A.25a.1:c.2888-39_2965del
        cDNA_position: ?-3051
        CDS_position: ?-2965
        Protein_position: ?-989
        Intron_number: 19/23
        Exon_number: 20/24
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: 216274/216275-216391/216392 (117 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele