WormBase Tree Display for Variation: WBVar02152874

WBVar02152874 Name: Public_name: ot762
    Other_name: CE35437:p.Ser226Leu
      C47C12.3a.1:c.638C>T
      C47C12.3b.1:c.677C>T
      CE33037:p.Ser213Leu
    HGVSg: CHROMOSOME_X:g.7748367C>T
  Sequence_details: SMap: S_parent: Sequence: C47C12
    Flanking_sequences: attgtggaaaaacgtacacgcatccaagct gttgcgcaaacacaccaaggtaagtcgtgtg
    Mapping_target: C47C12
    Type_of_mutation: Substitution: c t Person_evidence: WBPerson260
              WBPerson24049
    SeqStatus: Sequenced
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00047155
    Laboratory: OH
    Person: WBPerson260
    Status: Live
  Affects: Gene: WBGene00004335
    Transcript: C47C12.3b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: C47C12.3b.1:c.677C>T
        HGVSp: CE35437:p.Ser226Leu
        cDNA_position: 677
        CDS_position: 677
        Protein_position: 226
        Exon_number: 7/8
        Codon_change: tCg/tTg
        Amino_acid_change: S/L
      C47C12.3a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: C47C12.3a.1:c.638C>T
        HGVSp: CE33037:p.Ser213Leu
        cDNA_position: 646
        CDS_position: 638
        Protein_position: 213
        Exon_number: 7/9
        Codon_change: tCg/tTg
        Amino_acid_change: S/L
  Genetics: Interpolated_map_position: X -1.31239
  Description: Phenotype: WBPhenotype:0000640 Paper_evidence: WBPaper00059400
        Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: OH12225 ref-2(ot762); hdIs1[unc-53::gfp]; otIs348[unc-47::mCherry] Paper_evidence: WBPaper00059400
              Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Paper_evidence: WBPaper00059400
        Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: OH12225 ref-2(ot762); hdIs1[unc-53::gfp]; otIs348[unc-47::mCherry] Paper_evidence: WBPaper00059400
              Curator_confirmed: WBPerson712
      WBPhenotype:0000961 Paper_evidence: WBPaper00059400
        Curator_confirmed: WBPerson712
        Remark: mutants show a decrease in the number of unc-53::gfp expressing neurons in the L4, but not L1 stage, indicating a loss of unc-53::gfp expression in the postembryonically generated AS neurons, but not the embryonically born DA neurons; an unc-47::mCherry marker(otIs348; (Gendrel et al., 2016)) also fails to be expressed in postembryonically generated VD motor neurons of ot762mutants Paper_evidence: WBPaper00059400
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005334 PATO:0000460 Paper_evidence: WBPaper00059400
                Curator_confirmed: WBPerson712
            WBbt:0005303 PATO:0000460 Paper_evidence: WBPaper00059400
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000109 PATO:0000460 Paper_evidence: WBPaper00059400
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: OH12225 ref-2(ot762); hdIs1[unc-53::gfp]; otIs348[unc-47::mCherry] Paper_evidence: WBPaper00059400
              Curator_confirmed: WBPerson712
      WBPhenotype:0001312 Paper_evidence: WBPaper00059400
        Curator_confirmed: WBPerson712
        Remark: there is also a reduction in the number of embryonically generated DD neurons (Fig.1A,B); Analysis of a panneuronal marker, rab-3, indicates a reduced number of neurons in the ventral nerve cord (Fig.1C), supporting the possibility that AS, DD and/or VD neurons may not be generated. Paper_evidence: WBPaper00059400
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005270 PATO:0000460 Paper_evidence: WBPaper00059400
                Curator_confirmed: WBPerson712
            WBbt:0005300 PATO:0000460 Paper_evidence: WBPaper00059400
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000109 PATO:0000460 Paper_evidence: WBPaper00059400
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: OH12225 ref-2(ot762); hdIs1[unc-53::gfp]; otIs348[unc-47::mCherry] Paper_evidence: WBPaper00059400
              Curator_confirmed: WBPerson712
  Reference: WBPaper00059400
  Remark: [2020-03-14T01:04:46.988Z WBPerson712] New Variation: microPublication. we found that ot762 animals harbor a missense mutation in the 5th zinc finger domain of the highly conserved zinc finger transcription factor REF-2, Curator_confirmed: WBPerson712
    Current flanks border the codon as the exact bp change is unknown.
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004335 Missense 225 S to L Paper_evidence: WBPaper00059400
  Method: Substitution_allele